Research Article - (2022) Volume 8, Issue 3
Received: 04-Sep-2022, Manuscript No. IPBMBJ-22-14221; Editor assigned: 07-Sep-2022, Pre QC No. IPBMBJ-22-14221 (PQ); Reviewed: 22-Sep-2022, QC No. IPBMBJ-22-14221; Revised: 10-Mar-2022, Manuscript No. IPBMBJ-22-14221 (R); Published: 22-Mar-2022, DOI: 10.36648/2471-8084-9.1.111
For many years, intensive research on the early detection of lung cancer has been of interest to many scientists. Many studies recently focused on using microRNAs as an effective plasma biomarker for the diagnosis of different types of cancer including lung cancer. MIR-21 deregulation was observed in lung cancer patients and plays an important role in tumor development. In this present study, we investigated the plasma miR-21 biomarker as a non-invasive and cost-effective test for early detection of lung cancer among people working at a transportation center in Palestine since these people are exposed to a high level of Diesel Motor Emission (DME). Real time PCR revealed a significant increasing in the expression level of miR-21 in human plasma samples exposed to DME and in Non Small Cell Lung Cancer (NSCLC), than that of normal samples. Moreover, our results indicate a significant correlation between the quantity of plasma miR-21 and the exposure duration to DME (p˂0.05). These results confirm the significance of using miR-21 as a biomarker for the early detection of lung cancer among high risk people.
Plasma microRNA; MiR-21; Lung cancer; Diesel exhaust emissions; Biomarkers; Real time PCR
Lung cancer is a global problem and the most common type of cancer causing death. The mortality rate of lung cancer in palestine is highest among males than other tumors [1]. The prevention and treatment of lung cancer are successfully achieved when it was early detected. Moreover, 60%-80% survival at 5 years is investigated in patients diagnosed with early stage disease. Lung cancer is closely related to chemical and environmental factors which lead to genetic instability and tumor development. Because the majority of lung cancer patients are diagnosed with stage III or VI, novel plasma biomarkers for early detection of lung cancer are needed since they are simple, noninvasive and reliable diagnostic test [2].
Diesel Motor Emissions (DME) or diesel exhaust are a complex mixture of particles and gases containing hundreds of chemical compounds. Diesel exhaust particles are composed of a center core of elemental carbon and adsorbed organic compounds, in addition to a few amounts of nitrate, sulfate and metals. While nitrogen compounds, carbon monoxide, sulfur compounds and many hydrocarbons compounds such as benzene, aldehydes, Polycyclic Aromatic Hydrocarbons (PAHs) and nitro PAHs are classified as gaseous components [3]. DME contains highly mutagenic and carcinogenic particles, especially nitrous oxides and Polycyclic Aromatic Hydrocarbons (PAH).
MicroRNAs (miRNAs) are a family of non-coding small RNAs, which consist of 19 to 25 nucleotides and have main roles in the regulation of gene expression at the post-transcriptional level by either degradation of mRNAs through base pairing to the Untranslated Region (UTR) of the mRNAs molecule or by inhibition the translation process through preventing the binding of the ribosome to mRNAs molecule [4]. Furthermore, it has been suggested that miRNAs target and regulate about 30% of human genes involved in various biological functions, including cellular proliferation, cell death, fat metabolism and differentiation.
Many studies have proven that miRNA expression alterations occur not only in many human diseases but also in cancer. In addition, deregulation of miRNA expression was observed in tumor tissues with variations according to tumor type, compared with normal tissues [5]. miRNAs play an important role in tumor suppression, which contributes to the development of a malignant cell when loses its function by mutations and genomic alterations.
MiR-21
MiR-21 is 22 nucleotides located at 17 q23.1. It is classified as an oncogene and considered as anti-apoptotic factor. Over-expression of miR-21 minimizes the expression of apoptotic genes [6]. The over expression of miR-21 not only observed in lung cancer but also in breast cancer, colon cancer, liver and brain cancers. Recent studies on miR-21 were shown that it affects and suppresses four tumor suppressor genes including mapsin, Phosphatase and Tensin homolog (PTEN), Tropomyosin1 (TPM1) and Programmed Cell Death 4 (PDCD4). MiR-21 prevents the translation of these four genes by binding to their UTR of the transcript. The results are tumor growth, cell transformation and metastasis [7]. In this study, we evaluated the plasma miR-21 expression levels in people exposed to DME, patients with lung cancer and healthy individuals to validate it as an acceptable biomarker for early detection of lung cancer.
Study Population
The study population was 40 samples; divided into three groups, the first one is composed of 20 samples from people working at the downtown transportation center in Nablus for at least 4 hours of daily exposure to diesel exhaust emissions for a long time. The second group is consist of 10 samples from healthy individuals (cancer free control) and the final group is 10 samples of non-small cell lung cancer patients who are under treatment at An-Najah National University Hospital [8]. All samples were nonsmokers and healthy controls were free of cancer history.
Plasma Preparation
5 ml of peripheral blood samples were collected from all DME and healthy individuals at a private lab, while lung cancer control samples were collected at An-Najah university hospital. Clinical information was collected from each individual using a questionnaire [9]. Fresh whole blood samples in EDTA preservative were centrifuged immediately at 1900 g on 4°C for 10 minutes. Plasma was transferred to a new RNase-free tube. Plasma samples were centrifuged on 1600 g at room temperature for 10 minutes and then supernatants were transferred to new RNase free tubes and stored at -80°C until use.
Plasma RNA Extraction
Total RNA containing small RNA was extracted from 200 μl of plasma using miRNeasy serum/plasma kit (Qiagen) according to the manufacturer’s protocol. The final elution volume was 12 μl in RNase-free water. The concentration and purity of RNA samples were determined by NanoDrop 1000 (Thermo Fisher Scientific) [10].
Poly (A) Tailing of MiRNAs and cDNA Synthesis
25 μl of total RNA sample containing miRNA was polyadenylated using poly (A) polymerase (PAP, Ambion) and then reversely transcribed to cDNA using modified MMLV ultra script reverse transcriptase (PCR Biosystems) according to the manufacturer’s instructions with a poly (T) adapter primer (5’GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTT TTTTTT TTVN-3’) (Shi and Chiang, 2005).
MicroRNA Quanti ication by Real Time RT-PCR
SYBR Green based quantitative real time PCR assay was performed for miRNA expression quantification using 2 × qPCRBIO SyGreen Blue Mix Hi-ROX (PCR Biosystems) with specific forward primer and universal reverse primer which were complementary sequence to poly (T) adapter primers in Bio-Rad CFX Maestro system. The PCR was performed in duplicate as following steps: initial denaturation at 95°C for 2 minutes, then 50 cycles of 95°C for 5 seconds and 60°C for 30 seconds (Table 1).
| Primer | Sequence |
|---|---|
| Universal reverse primer | 5’-GCGAGCACAGAATTAATACGACTCA -3’ |
| miR-21 (forward) | 5’-TAGCTTATCAGACTGATGTTGA -3’ |
Table 1: The sequences of primers.
Generation of the Standard Curve for Absolute Quantification of MiRNAs
Synthetic single stranded miRNA as an internal control for miRNA expression profiling (miRNeasy serum/plasma spike-in control) was purchased from Qiagen. Synthetic spike-in miRNA (Ce_miR-39) was polyadenylated and reverse transcribed to cDNA according to the manufacturer’s protocol in order to generate a standard curve for the miRNA SYBR PCR assays [11]. The assessment of RNA recovery was achieved by comparing CT value to a synthetic miRNA standard curve generated independently of the RNA extraction. The absolute concentration of spike-in control was 1 x 106 copies/μl. Serial dilutions of spike-in control cDNA were prepared for standard curve generation for estimation of the recovery of spike-in control which was added to the plasma samples.
Sensitivity, Specificity, PPV and NPV of MiRNA Quantification by Real-Time PCR
95% of DME exposed samples show over expression of miR-21 in comparison to spike-in control [12]. No amplification occurs in NTC (no Ct value) as evidence of the absence of any contamination and primer dimer amplification. Also, all lung cancer patients’ samples show an elevation in the expression of miR-21 compared with spike-in control. While 90% of these samples show over expression compared with healthy control samples with 95% sensitivity and 60% specificity, while PPV and NPV were 82.6% and 85.7% respectively (Figure 1).
Figure 1: MiR-21 expression of all DME exposed samples (1 to 20), spike-in control and Non-Template Control (NTC) using qPCR.
The comparison between the expression of miR-21 and Cel_miR-39 spike-in control in all samples including DME exposed samples, healthy control and lung cancer patients control were shown in the above figures. Nineteen samples out of twenty DME exposed samples showed over expression of miR-21 (95% of all DME exposed samples) [13]. While 100% of lung cancer patients control samples and 40% of healthy controls showed over-expression of plasma miR-21 (Figure 2).
Figure 2: MiR-21 expression of healthy samples (21 to 30), lung cancer patients (31 to 40), spike-in control and Non Template Control (NTC) using qPCR.
Identification of Lung Cancer Biomarker for High Risk People
The comparison between all groups in the quantity of plasma miR-21 is shown in the above figure [14,15]. DME exposed samples have a higher mean (7.01, SD=1.44), while the healthy controls have a lower (5.66, SD=0.48), while the mean for lung cancer controls was (6.96, SD=0.58). Based on the significant difference in means between these three groups (ANOVA, F=4.552, P˂0.05), healthy controls are responsible for the significant difference compared with DME exposed people and lung cancer patients based on post hoc comparison (Figure 3).
Figure 3: Box plot shows the correlation between plasma levels of MIR-21 in healthy control (cancer-free control), DMEexposed people, and lung cancer patients. The line inside the boxes denotes the medians. The boxes mark the interval between the 25th and 75th percentile. The Whiskers denote the interval between the 5th and 95th percentiles.
Efforts are focusing on the early detection of cancer including lung cancer to reduce the mortality [16,17]. Human cancer exhibits an alteration in the miRNAs profile with tumor suppressive and oncogenic activity [18]. MiRNAs proved their ability in the early detection of lung cancer and are considered a biomarker depending on many studies in this field. Many recent studies investigated the relationship between the upregulation of miR-21 and different human cancers. It has been reported that miR-21 suppresses PTEN which can induce apoptosis, control cell growth and angiogenesis. The expression of miRNAs varies in plasma samples of high cancer risk people who are exposed to different carcinogens including DME. In our study, we focused on the plasma levels of miR-21 in people who work at a high intensity of DME which may be related to lung tumorigenesis [19]
In our results, 95% of DME exposed samples show over expression of miR-21 [20] Moreover, 40% of healthy controls and 100% of lung cancer patients’ samples control show over expression of plasma miR-21 level (Table 2). However, miR-21 is not a specific biomarker for lung cancer only, but also for different types of cancer including breast cancer, colon cancer, hepatocellular carcinoma and glioblastoma [21].
| Healthy C. | DME exposed | Cancer C. | |
|---|---|---|---|
| M (SD) | M (SD) | M (SD) | |
| Log starting quantity of miR-21 | 5.66 (0.48) | 7.01 (1.44) | 6.96 (0.58) |
| Age | 32.80 (13.08) | 45.90 (12.06) | 60.2 (4.62) |
| No. of years in the transportation center | 0 | 10.50 (2.87) | N/A |
| Exposure duration (hrs /day) | 0 | 3.60 (0.681) | N/A |
| Total Exposure duration (hrs) | 0 | 11918.40 (4411.88) | N/A |
| miR-21 expression | n (%) | n (%) | n (%) |
| Normal regulation | 6 (60%) | 1 (5%) | 0 (0%) |
| Up regulation | 4 (40%) | 19 (95%) | 10 (100%) |
| Smoking history | 0 (0%) | 0 (0%) | 8 (80%) |
| Male | 8 (80%) | 20 (100%) | 10 (100%) |
| Adenocarcinoma | N/A | N/A | 8 (80%) |
| Squamous cell carcinoma | N/A | N/A | 2 (20%) |
Table 2: Demographic and histopathologic data for plasma samples.
The expression of miR-21 in DME exposed samples 8 and 13 was the most with a starting quantity of 7466.18 × 105 and 4518.5 × 105 copies/μl respectively. These results indicate the high exposure intensity of DME for these people working at the transportation center which is about 6 hours daily for 15 years depending on the participants’ history and questioners [22].
Although all lung cancer patients participating in this research are under treatment at An-Najah National University Hospital, the results show a significant elevation in the expression of miR-21 compared with healthy and spike-in control with 95% sensitivity. The relatively low false negative results mean the ability to identify most of lung cancer patients with a disease. The high sensitivity and relatively high specificity indicate that they could discriminate plasma samples of DME exposed from healthy controls and they will be a novel noninvasive biomarker for early detection of non-small cell lung cancer. Recently, Shen concluded that the plasma level of many miRNAs including miR-21 is useful for discriminating healthy controls from Non-Small Cell Lung Cancer (NSCLC) patients with 86.22% sensitivity and 96.55% specificity, which supports the hypothesis that miRNAs may use as novel biomarkers for early detection of lung cancer.
In Our results, there is a statistical significance difference between three groups (healthy control, DME exposed and lung cancer patients control) and the number of miRNAs in plasma samples. Importantly, miR-21 was significantly over expressed in DME exposed people and lung cancer patients compared with healthy control. This study provides a shared of evidence that occupational exposure to DME correlates with elevation of the expression of miR-21, which is considered a biomarker for high risk of lung cancer depending on the results that showed an odds ratio of OR=28.5 (95% CI 2.6-306). On another hand, high NPV obtained from results using real time PCR for quantification of plasma miR-21 of high risk people with high-intensity exposure to DME indicates the ability to depend on this screening for early detection and there is less need for other expensive and invasive tests such as chest biopsy and chest CT.
There is a great need to develop early detection screening tests for lung cancer since the rate of mortality is increased when the disease is diagnosed in its later stages. In conclusion, our study strengthens the arguments which report plasma miR-21 could be a potential non-invasive and cost effective biomarker for early detection and diagnosis of lung cancer. Due to the few reports on the plasma biomarkers for early detection of different cancer types in palestine, the results of this study have confirmed the significance of using miRNAs in the early detection of cancer. Many further studies on different miRNAs such as miR-155, miR-15a, miR-15b, miR-126, miR-127 and miR-197 which are implicated in human lung cancer are needed.
We thank Mahmoud Ruzaygat for his consultation in qPCR and Dr. Jamal Qaddumi for his assistance in statistical analysis. This study was mainly supported by An-Najah National University and An-Najah University Hospital.
[Crossref] [Googlescholar] [PubMed]
[Crossref] [Googlescholar] [Indexed]
[Crossref] [Googlescholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Googlescholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Crossref] [Googlescholar] [PubMed]
[Crossref] [Googlescholar] [PubMed]
[Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
[Google Scholar] [PubMed]
[Crossref] [Google Scholar] [PubMed]
Citation: Slaileh AI, Sawafta A, Alkowni R (2023) Deregulation of Plasma Mir-21 for Early Detection of Lung Cancer among Palestinian People Exposed To High-Intensity of Diesel Exhaust Emissions. Biochem Mol Biol J. 9:111.
Copyright: © 2022 Slaileh AI, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.
