Research Article - (2016) Volume 2, Issue 1
Rodrígue L1,3, Rosa A2 and Jewtuchowicz V1
1Department of Microbiology, University of Buenos Aires, Parasitology and Immunology-IMPaM-UBA-CONICET, Federal Capital, CABA, Argentina
2Department of Microbiology and Parasitology, Faculty of Dentistry, University of Buenos Aires, Argentina
3Department of Semiotics and Clinical Diagnostics, Faculty of Dentistry, University of Cuenca, Ecuador
Received: April 12, 2016; Accepted: April 20, 2016; Published: April 29, 2016
Citation: Rodrígue L, Rosa A, Jewtuchowicz V. Identification to Species Level of Candida parapsilosis Complex into Sites Oral Cavity in a Cohort of Argentinos Patients. J Infec Dis Treat. 2016, 2:1. doi:10.21767/2472-1093.100012
Candida parapsilosis is a complex of three species (Cp. sensu stricto, Candida orthopsilosis and Candida methapsilosis) due to genetic heterogeneity. Currently, it is the second most isolated in yeast bloodstream infections in Latin America, Asia and Europe. In Argentina and globally is no data on the distribution and behavior of the species that make up this complex in oral niches. Knowledge becomes important in the event that the mouth can be a potential source of candidemia and / or invasive infections by this yeast in patients with other risk factors source. Objective: To identify to species C. parapsilosis complex in clinical isolates obtained from various oral niches, of a cohort of Argentinos patients with different bucodentarias clinical situations. Methods: Retrospective, transversal and descriptive study using 31 clinical isolates of oral cavity, cryopreserved and obtained from immunocompetent patients with and without periodontal disease, and presence or absence of intraoral appliances; previously recognized by conventional methods such as C. parapsilosis, and recovered for molecular characterization endpoint PCR using specific primers. Results: 100% (31/31) of the isolates were positive for Candida parapsilosis sensu stricto. 77.5% of these strains were recovered in oral inflammatory conditions, and 22.5% in terms of oral health. Being statistically significant difference (p=0). Conclusions: C. parapsilosis sensu stricto is a common colonizing the oral mucosa, especially in pathological conditions.
Candida parapsilosis complex; Candida parapsilosis sensu stricto; Candida orthopsilosis; Candida methapsilosis; Oral niches
Candida parapsilosis is a complex of three species (Candida parapsilosis sensu stricto, Candida orthopsilosis, and Candida methapsilosis) due to its heterogeneity genética [1].In recent years C. parapsilosis has emerged as an emerging nosocomial pathogen, and currently is the second most isolated in yeast bloodstream infections in Latin America, Asia and Europe [2]. It is the kind sensu stricto the most prevalent, especially in inmunocompetentes [3] subjects. It is known from literature that this species is the second more asylee after Candida albicans in bucal cavity [4]. In Argentina and globally are no data on the distribution and behavior of the species that make up this complex in oral niches, knowledge becomes important in the event that the mouth can be a potential source of candidemia and / or invasive infections this yeast in patients with other risk factors.
Objective
Perform identification to species level of Candida parapsilosis complex on clinical a isolates into sites oral cavity, in cohort of Argentinos patients with different bucodentarias clinical situations.
Retrospective, transversal and descriptive study, that used 31 clinical isolates of oral cavity, cryopreserved and obtained ambulatory and immunocompetent patients with and without periodontal disease, and with presence or absence of intraoral appliances; previously recognized by conventional methods such as C. parapsilosis, and recovered for molecular characterization with endpoint PCR using specific primers (CPAR, CPAF, COOR, COOF, CMEF, CMER) [5] (Table 1), derivatives of unique sequences contained in the internal transcriptional spacer 1 (ITS 1-5.8rRNA-ITS2) ribosomal DNA fúngico [5]. Data were processed in Microsoft Excel 2010. For quantitative and qualitative analysis, Stadisticx 7.0 and SPSS programs were used; with a confidence interval of 95% and alpha error of 0.05, statistical significance considering a p-value minor to alpha error. The statistical association was assessed with chi square test and prevalence ratio.
Primers | Gene | Direction | Species specificity | Sequence | Amplicon |
---|---|---|---|---|---|
CPAF | ITS 1 | Forward | C. parapsilosis | TTTGCTTTGGTAGGCCTTCTA | 379pb |
CPAR | ITS 2 | Reverse | GAGGTCGAATTTGGAAGAAGT | ||
CORF | ITS 1 | Forward | C. orthopsilosis | TTTGGTGGCCCACGGCCT | 367pb |
CORR | ITS 2 | Reverse | TGAGGTCGAATTTGGAAGAATT | ||
CMEF | ITS 1 | Forward | C. methapsilosis | TTTGGTGGGCCCACGGCT | 374pb |
CMER | ITS 2 | Reverse | GAGGTCGAATTTGGAAGAATGT |
Source: Asadzadeh et al. [5]
Table 1: Sequence of primers used for the rapid identification at the species level C. parapsilosis complex.
A total of 31 C. parapsilosis strains were recovered and molecularly evaluated in this study; obtained from different oral niches as buccal mucosa, palate, tongue and gingival sulcus. Of the 31 strains, seven were obtained from the collection of isolates of Mycology Center-UBA, and 24 came from Gandulfo Hospital (Table 2). All (100%) isolates were positive for Candida parapsilosis sensu stricto (Figure 1). 77.5% of these strains were recovered in oral pathological conditions, with clinical forms of gingivitis and periodontitis (Table 3). It was statistically significant difference (p=0); with a prevalence ratio of 3.35, which means that there are three times more likely to isolate C. parapsilosis sensu stricto in an oral cavity under inflammatory conditions compared to oral cavity health conditions (Table 4). On the other hand, 54.8% (17/31, p=0.6115) strains came from patients with prosthetic or orthodontic devices, however not statistically significant was obtained (Table 5).
Strain | Source | Site | Species |
---|---|---|---|
10.2 | Gandulfo | Buccal mucosa | Sensustricto |
13.2 | Gandulfo | Buccal mucosa | Sensustricto |
15A | Gandulfo | Subgingival | Sensustricto |
51.2 | Gandulfo | Buccal mucosa | Sensustricto |
14.2 | Gandulfo | Buccal mucosa | Sensustricto |
15.1 | Gandulfo | Buccal mucosa | Sensustricto |
16.1 | Gandulfo | Buccal mucosa | Sensustricto |
23.2 | Gandulfo | Buccal mucosa | Sensustricto |
7.2 | Gandulfo | Buccal mucosa | Sensustricto |
11.1 | Gandulfo | Buccal mucosa | Sensustricto |
36.1 | Gandulfo | Buccal mucosa | Sensustricto |
53A | Gandulfo | Subgingival | Sensustricto |
40A | Gandulfo | Subgingival | Sensustricto |
12A | Gandulfo | Subgingival | Sensustricto |
50A | Gandulfo | Subgingival | Sensustricto |
50.1 | Gandulfo | Buccal mucosa | Sensustricto |
73A | Gandulfo | Subgingival | Sensustricto |
16A | Gandulfo | Subgingival | Sensustricto |
23B | Gandulfo | Subgingival | Sensustricto |
32B | Gandulfo | Subgingival | Sensustricto |
75CA | Gandulfo | Cheek | Sensustricto |
78LE | Gandulfo | Tongue | Sensustricto |
6LE | Gandulfo | Tongue | Sensustricto |
6PA | Gandulfo | Palate | Sensustricto |
4220 | Gandulfo | Buccal mucosa | Sensustricto |
4757 | Micologycenter | Buccal mucosa | Sensustricto |
5299 | Micologycenter | Buccal mucosa | Sensustricto |
5301 | Micologycenter | Buccal mucosa | Sensustricto |
5462 | Micologycenter | Buccal mucosa | Sensustricto |
6912 | Micologycenter | Buccal mucosa | Sensustricto |
7066 | Micologycenter | Buccal mucosa | Sensustricto |
Table 2: Molecular identification of 31 isolates previously defined by phenotypic methods as C. parapsilosis.
Species | Gingivitis | Periodontitis | Oral health | Total |
---|---|---|---|---|
Sensustricto | 6(19.4%) IC95%:7.5-37.5 | 18(58.1%) IC95%:39.3-74.9 | 7(22.5%) IC95%:9.6-41.1 | 31 (100%) |
Orthopsilosis | 0 | 0 | 0 | 0 |
Methapsilosis | 0 | 0 | 0 | 0 |
Total | 19.4% | 58.1% | 22.5% | 100% |
Table 3: Relationship between parapsilosis species complex and oral clinical condition: 77.4% of the isolates were isolated in inflammatory oral conditions.
Inflamación | Cpsensustricto | |
---|---|---|
oral | Nº | % |
Presente | 24 | 77 |
Ausente | 7 | 23 |
Total | 31 | 100 |
CHI2 (Yates)=16,5161; GL=1; p=0; Prevalence ratio: 3.35
Table 4: Distribution of Candida parapsilosis sensu stricto according to presence or absence of oral inflammation.
Intraoral device | Species sensustricto |
---|---|
Nº (%) | |
Present | 17 (54.8%) |
Absent | 14 (45.2%) |
Total | 31 (100%) |
*CHI2 (Yates)=0,258 1; GL=1; p=0.6115 Prevalence ratio: 1.21
Table 5: Distribution of the species C. parapsilosis sensu stricto according to presence or absence of intraoral devices.
Of the complex, C. parapsilosis sensu stricto is the most isolated species in clinical isolates derived from immunocompetent patients both pathological conditions and such commensal [6,7]. This is knowledge that has been supported by many studies worldwide. However there are few studies reporting the prevalence and distribution of species of this complex health conditions and disease to level oral. So far it is known that C. parapsilosis sensu stricto is the most prevalent species in oral niche in conditions of immune-competence, regardless of geographic region. This has been reported studies from USA [4], Portugal [8], Turkey [9] and China [10]. While a single work in Brazil, investigated the distribution of species of this complex in oral cavity of chronic immunocompromised patients for HIV, in which C. methapsilosis was the most isolated species followed by C. parapsilosis sensu stricto, although the difference it was not statistically significant, and also the sample used was very escasa [2].
In the present study, was isolated only C. parapsilosis sensu stricto, with 100% prevalence of total recruited samples of oral cavity from immunocompetent patients. This result is similar to that reported by other authors as Ghanoun et al. [4]; Enger et al. [11]; Silva et al. [8]; Ge et al. [10]; and Tosun et al. [9] (Table 6).
Nº de aislamientos (%) porespecies | |||||
---|---|---|---|---|---|
Author | C. parapsilosis | C. orthopsilosis | C. metapsilosis | Área de origen | Referencia |
Ghannoum et al. | 3 | 0 | 1 | USA (2010) | [4] |
Ge et al. | 2 | 0 | 1 | China (2012) | [10] |
Moris et al. | 7 | 0 | 8 | Brasil (2014) | [2] |
Enger et al. | 9 | 5 | 0 | Global (2001) | [11] |
Silva et al. | 65 | 0 | 4 | Portugal (2009) | [8] |
Tosun et al. | 2 | 0 | 0 | Turkia (2012) | [9] |
Presenteestudio | 31 | 0 | 0 | Argentina | - |
Table 6: Distribución de especies del complejo C. parapsilosis en nichos de cavidad bucal, resumido de estudios publicados.
By relating the species found with oral clinical conditions at the time of sampling, according to data recorded in the medical history of each patient, we obtained that C. parapsilosis sensu strictodominated inflammatory oral conditions compatible withforms clinics gingivitis and periodontitis, predominating in the latter group in particular (Tables 3 and 4). On the other hand, by correlating of the isolate recovered with the use of intraoral devices, although, C. parapsilosis sensu stricto predominated in the group of patients with some form of intraoral appliances, however, the difference was not statistically significant compared to non-carriers (Table 5). There are no published data to contrast our results.
1. C. parapsilosis sensu stricto is a regular colonizing the oral mucosa, especially in pathological conditions. In this context, the mouth becomes a potential source of candidemia or invasive infections by this yeast; besides being a possible source of transmission for this fungus, by direct contact from person to person.
2. It’s probably that C. methapsilosis and C. orthopsilosis are two strange species in niche oral cavity under both health and disease.
3. Until now, this is the first study that studies the distribution of the species complex in oral niches in a collection of more than 20 clinical isolates, in addition, the study considers the situation dental clinic at the time of sampling, which is not seen in other reports concerning the subject.
It is suggested to apply the formatting of the study in a larger sample and a prospective model to validate these reported in this paper results.
The work was funded by the grant from the University of Buenos Aires UBACyT 20020120200119.