Research Article - (2020) Volume 6, Issue 2
Department of Biology, Faculty of Science, Shahid Chamran University of Ahvaz, Ahvaz, Iran
Received Date: April 10, 2020; Accepted Date: May 11, 2020; Published Date: May 12, 2020
Citation: Kazemi Nezhad SR (2020) MiR- 605-5p is a Potential Tumour Suppressor microRNA in Colorectal Adenocarcinoma. Biomark J. Vol. 6 No. 2: 68.
DOI: 10.36648/2472-1646.6.2.68
Colorectal cancer (CRC) is a major cause of morbidity and mortality worldwide. Countries with the highest incidence rates contain Australia, New Zealand, Canada, the United States, and parts of Europe. The countries with the lowest risk contain China, India, and parts of Africa and South America. Iran, as an intransition country, is meeting population aging and rising prevalence of the western lifestyle. Therefore, continuing rising burden of colorectal cancer (CRC) is reasonably awaited in future years, while its incidence and mortality rates are still relatively high in Iran. CRC is responsible for 8.4% of all cancers in Iran, where it is the third most common cancer in men and the fourth most common cancer in women, with standardized incidence rates of 8.1-8.3 and 6.5-7.5 per 100 000, respectively; moreover. Most cases of colorectal cancer occur sporadically. Although the etiology of colorectal cancer is multifactorial, genetic and epigenetic alterations of proto-oncogenes and tumor suppressor genes stay the fundamental mechanism of tumorigenesis.
Colorectal cancer; RNA; Tumor; Tissues; Gene; Diagnosis; Carcinogenesis
MicroRNAs (miRNAs) are 19-25 nucleotide non-coding regulatory RNAs, that participate in a variety of developmental pathways. The deregulation of microRNAs has been reported in human cancers. Recent data have shown that miR-605-5p plays an important role in the apoptosis and tumorigenesis [1-6]. It is suggested that miR-605-5p is a new component in the P53 gene network with post-transcriptionally repressing Mdm2 [7]. Its downregulation has been reported in lung, breast, prostate and colorectal cancer cell lines [7-10]. However, its potential role in colorectal cancer is remained to be unknown.
In the present study, we investigated the miR-605-5p expression in colorectal tumor samples compared to the colorectal normal adjacent tissues. To our knowledge, this is the first report indicating the potential tumor suppressor role of miR-605-5p in colorectal cancer and correlation with the expression of level of P53 and P21.
In silico study
In this study, we used YM500 database (http://ngs.ym.edu.tw/ym500/), containing analysis pipelines and analysis results of 609 human and smRNA-Seq results, including public data from the Cancer Genome Browser (TCGA) Data Base. The expression level of miR-605-5p was checked in 455 solid tumor tissues compared eight solid normal tissues of colon adenocarcinoma and 161 Solid Tumor tissues compared with three Solid normal tissues of rectum adenocarcinoma. Data include of the log2 ratio (tumors compared to adjacent normal tissues) colon and rectum adenocarcinoma and the expression boxplot by sample types for each cancer type.
Patients’ samples
The Ethical Committee of Shahid Chamran University (Ahvaz, Iran) approved this study (Ethics Research Code: EE/96.24.388334/ scu.ac.ir). In this study, tumor and adjacent normal samples (as controls) of colorectal tissues from 31 subjects with colorectal adenocarcinoma were studied in order to compare the expression level of miR-605 between the tumor and normal tissues.
Selection and preparation of tissue samples
Sixty two tissue samples including the colorectal tumor and margin normal tissues were collected from the Iranian Tissue Bank (ITB) and were immediately transferred to the temperature of -80℃.
RNA extraction
RNA isolation from tumor tissue samples and colorectal tumor margins were manually administered using RNX-Plus reagent (Cinna Gene, Iran) according to the manufacturer’s instructions Total tissue RNA was evaluated qualitatively and quantitatively with nanodrop Spectrophotometer and gel electrophoresis.
Reverse Transcription-PCR reactions
The RNAs (1 μg) were mixed with oligo (dT) or miRNA-specific stem-loop RT primers, and were reverse transcribed to cDNA using Prime Script™ 1st strand cDNA Synthesis Kit (Takara, Japan). The 10ml reaction volume were incubated in a Flex Thermocycler (Analytik Jenta) in a 48 well plate for 30 min at 16°C, 30 min at 42°C, 5 min at 85°C and then held at 4°C. For P21 and P53 mRNAs, it was incubated for 15 minutes at 37 degrees and then at 85 degrees for 5 seconds.
Real time-PCR
Real-time PCR was performed using a SYBR Premix Ex TaqTM II (Takara, RR820L, Japan) PCR kit protocol on an Applied Biosystems Step One Sequence Detection System (Applied Biosystems). In this step, the forward primers (miR-605-5p-Fwd) and the universal reverse primer (Rev) were used to analyze the expression of miR- 605. SNORD47 snRNA was used for normalization. Paired primers (Fwd and Rev of P21 and P53) were also used to determine P21 and P53 mRNAs expression. The level of GAPDH mRNA was used as an endogenous control. The sequences of the primers used in the multiplication reaction are given in Table 1. All Reverse transcriptase reactions, including no-template controls and RT minus controls, were run in duplicate.
Table 1 The sequence of the specific primers used in the reverse transcription reaction and the Forward and Reverse primers used in Real-Time PCR reaction.
| F Primer miR-605: | TGCGGTAAATCCCATGGTGCCTTC |
| R Primer miR-605: | CCAGTGCAGGGTCCGAGGT |
| RT Primer miR-605: | GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACAGGAGAAG |
| F Primer P21 gene: | TGGAGACTCTCAGGGTCGAAA |
| R Primer P21 gene: | CGGCGTTTGGAGTGGTAGAA |
| F primer p53 gene: | TAACAGTTCCTGCATGGGCGGC |
| R primer P53 gene: | AGGACAGGCACAAACACGCACC |
| F Primer Snord47: | ATCACTGTAAAACCGTTCCA |
| R Primer snord47: | GAGCAGGGTCCGAGG |
| RT Primer Snord47: | GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACCT |
| F Primer GAPDH: | GTGAACCATGAGAAGTATGA |
| R Primer GAPDH: | CATGAGTCCTTCCACGATAC |
Statistical analysis
Fold changes were calculated using the 2-ΔΔCt method [11]. Significance was delineated as P<0.05. Statistical analysis was carried out by the Graph Pad Prism 6 using two-tailed Student’s test. Data were present as means ± SEM (standard Mean). The correlation between the expression of miR-605-5p and P21 was analyzed using Pearson’s correlation. The relationship between miR-605 expression and clinicopathologic characteristics of CRC was analyzed using Graph pad prism 6 software using by nonparametric tests (Mann witney test U). The hierarchical clustering curve was drawn to show changes in the log2 expression level of genes in the samples with R statistics software.
In silico studies showed miR-605 as a potential tumor suppressor miRNA in colorectal cancer
The results obtained from the studies of in silico analysis indicated the downregulation of miR-605-5p in solid tumor tissues compared with colon Figure 1A and rectum solid normal tissues Figure 1B (www.Ym500). Through GEO datasets, the fold change and P value showed significant changes of expression between tumors and normal tissues, although the adjusted P value were not below than 0.05 Table 2. So, for validation study, qRT-PCR experimental data on CRC tissues was run as below.
Figure 1: The Ym500 DB study indicates a decrease of miR-605- 5p expression in colon adenocarcinoma compared to normal colon tissue (A). Also, it shows a downregulation of the miR-605-5p expression in rectum adenocarcinoma compared with normal rectum tissue (B).
Table 2 The results of GEO database study of miR-605 expression levels in tumor and normal tissues of subjects.
| GEO Accession Number | Samples | Adj. P value | P value | Log FC |
|---|---|---|---|---|
| GSE35602 | 8 normal | 0.0696 | 0.00348 | -1.33506 |
| 17 tumor | ||||
| GSE35982/981 | 8 normal | 0.191 | 0.003119 | -4.79 |
| 8 tumor | ||||
| GSE41655 | 15 normal | 0.155 | 0.0379 | -0.621 |
| 92 tumor |
miR-605 is downregulated in colorectal tumor tissues compared with normal tissues
qRT-PCR was performed in order to detect the relative expression of miR-605 in CRC tumor compared with normal tissues. As shown in Figure 2, miR-605-5p expression was significantly downregulated in colorectal tumor tissues relative to matched normal tissues (p<0.0001, fold change=0.498). There was not any significant correlation between miR-605 expression and most patient characteristics, including, Age, Gender, Tumor site, Depth of tumor, lymphatic metastasis, TNM system Table 3.
Figure 2: Analysis of the expression level of miR-605-5p in 31 samples of tumor tissue compared to the colorectal adjacent tissue (n=31) showed a significant down regulation (P value < 0.0001, Fold change = -0.798). The data is given as Mean ± SEM.
Table 3 The correlation between miR-605 expression and patient characteristics. miR-605 expression was normalized against SNORD47 RNA levels.
| Variables | Cases (n) | P Value |
|---|---|---|
| Mean Age: | ||
| < 62 | 16 | 0.891 |
| ≥ 62 | 15 | |
| Gender: | ||
| Male | 15 | 0.231 |
| Female | 16 | |
| Location: | ||
| Colon | 16 | 0.228 |
| Rectum | 15 | |
| Tumor size: | ||
| < 5 | 16 | 0.654 |
| ≥ 5 | 15 | |
| Lymphatic Metastasis: | ||
| Yes | 15 | 0.437 |
| No | 15 | |
| TNM Stage | ||
| I + II | 22 | 0.653 |
| III + IV | 9 | |
| Histological Grade: | ||
| Well and moderately | 11 | 0.855 |
| Poorly | 20 | |
Downregulation of miR-605 did not show any significant correlation with P53 and P21 expression
Based on previous studies, it was assumed that by repressing Mdm2, “miR-605” can increased the P53 transcriptional activity. So, P53 transcriptional activity was checked by analysis the mRNA levels of P53 target gene P21. It was found that P21 expression was significantly down regulated in colorectal tumor tissues relative to matched normal tissues (P<0.05, fold change=- 1.042) Figure 3. However, the analysis demonstrated that the expression levels of miR-605-5p are not significantly correlated with the levels of P21 mRNA (P>0.05).
Figure 3: Comparison analysis of P21 expression in 31tumor tissue compared with normal samples. The data shows a significant decrease (P value = 0.048, fold change = -1.042). The logarithmic normalized expression is given in the image.
We also checked the expression level of P53 to find its correlation with miR-605 expression. It was found that P53 expression was significantly downregulated in colorectal tumor tissues relative to matched normal tissues (P<0.0006, fold change=0.682). However, our analysis showed that the relative expression level of miR-605 in tumor tissues was not correlated with the levels of P53 mRNA (P>0.05) In order to show the levels of gene expression changes in samples and the relationship between genes expression changes, the hierarchical clustering curve was drawn up the hierarchical clustering curve Figure 4. Reduced expression is observed in most samples for three genes. The blue color indicates that the reduction of expression and the red color represents the higher expression.
Figure 4: Hierarchical clustering result of 3 differentially-expressed genes. Each column represents the expression profile log 2 form of a gene across 31 samples and each row represents a sample. Blue and red colors respectively indicate either lower or higher expression levels of the gene. The genes-expression Pheatmap is drawn by the R statistical software.
MiRNAs are a class of non-coding RNAs that regulate the progression of cancer cells by targeting downstream genes. The original function of miRNA is regulating protein-coding gene expression post-transcriptionally by directly base pairing between the 5ʹ seed region of a miRNA and the 3ʹ untranslated region (3ʹUTR) of multiple target messenger RNA (mRNA), resulting in translational repression or mRNA degradation and lacking the ability to encode proteins [4,12-15]. One miRNA can regulate various genes expression [16]. It has been reported that miRNA expression profiles differ between normal and cancer tissues [17].
In recent years, studies have shown that the study of changes in the expression of miRNAs, which act as a new class of oncogenes and tumor suppressor genes, is important for the diagnosis and treatment of cancer [18]. In the future, cancer research will focus on the relationship between miRNAs and cancer due to the importance of miRNAs. Recently, the genetic variants and deregulation of miR-605 have been reported to participate in carcinogenesis [9]. In 2011, Xiao and colleagues demonstrated that a microRNA named miR-605 is a new component of the P53 gene network, being transcriptionally activated by P53 and posttranscriptionally repressing Mdm2. Activation of P53 upregulated miR-605 via interacting with the promoter region of the gene. The precursor sequence of miR-605 is placed within the intron 2 of PRKG1 at the genomic location of 52 729 339–52 729 421 in the chromosome 10 [7]. In response to cellular stress, the expression of miR-605 increases as a result of activation of P53 and then miR-605 inhibits Mdm2 by inhibiting Mdm2, which acts as a P53 inhibitor [7]. In 2014, Zhou and his colleagues concluded that miR-605 induced apoptosis in response to DNA damage by inducing ionizing radiation on four model mice [8]. In recent years, researchers have found that the genetic variants or deregulation of miR-605 are reported to be associated with the susceptibility of various cancers, including gastrointestinal cancer [19,20], and lung cancer [21], intrahepatic cholangiocarcinoma [16], melanoma [9], prostate cancer [10,22,23].
However, the expression status of the miR-605 in colorectal cancer tissues and its role in colorectal cancer progression are unclear. In this study, we found that miR-605 showed decreased expression in tumor tissues by in silico and experimental validation studies. The data indicates the potential role of this microRNA in CRC initiation and progression. Furthermore, we have analyzed the correlation between miR-605 expression and patient characteristics of patients with colorectal cancer. Xiao et al, found that miR- 605 can be potentially involved in P53 pathway [7]. Since the increase in P53 transcriptional activity by miR-605 was previously evidenced by elevated mRNA levels of P53 target gene P21 [7]. We checked the correlation between the expression level of miR- 605 and P21 in tumor and normal tissues. Although the analysis showed a significant reduction of P21 level in colorectal tumor samples compared with the colorectal normal adjacent tissues, we did not observe any significant correlation with fold change of miR-605 expression. Also, the expression level of P53 did not correlate with miR-605 expression in our samples. This can be attributed to P53 status in tumors or the potential involvement of miR-605 in other pathways [7,24,25]. The expression level of miR-605 and its correlation with the status of P53 was beyond of this study. So, the molecular mechanism of this miRNA is needed to be checked by more in vitro and in vivo studies as well as more clinical samples. Furthermore, the hypothesis can be checked by more clinical samples.
Although additional studies are required to address the mechanism involved in the reduced expression of miR-605, our results indicates that miR-605 may provide novel insight into molecular basis regulating colorectal cancer malignancy. To our knowledge, this is the first study indicating miR-605 as a potential tumor suppressor microRNA in colorectal cancer.
The present study is a graduate student dissertation which was conducted in the molecular laboratory of the Department of Genetics, Shahid Chamran University of Ahvaz. We thank the ITB Center of Clinical and Pathological Diagnosis for providing sections of colorectal cancer tissues.
Conceptualization: Zeynab Mashayekh, Data curation: Zeynab Mashayekh. Formal analysis: Zeynab Mashayekh. Funding acquisition: Seyed Reza Kazemi Nezhad, Mohammadreza Hajjari. Investigation: Zeynab Mashayekh. Methodology: Zeynab Mashayekh, Mohammadreza Hajjari. Project administration: Seyed Reza Kazemi Nezhad, Mohammadreza Hajjari, Software: Zeynab Mashayekh. Supervision: Mohammadreza Hajjari, Seyed Reza Kazemi Nezhad. Validation: Zeynab Mashayekh. Visualization: Zeynab Mashayekh. Writing — original draft: Zeynab Mashayekh. Writing-review and editing: Zeynab Mashayekh, Mohammadreza Hajjari, Seyed Reza Kazemi Nezhad. Finally, all authors discussed the results and contributed to the final manuscript.
This work was supported by grant from Shahid Chamran Unversity of Ahvaz, Iran.
There is no conflict of interest among the authors.
